G::Seq::PatSearch - component of G-language Genome Analysis Environment

    This class is a part of G-language Genome Analysis Environment, 
    collecting sequence analysis methods related to GC skew.

    my $first = lc(shift);
    my $second = lc(shift);
    my $gtmatch = shift;
    die("First two arguments must be single base (i.e. a, t, g, or c).\n")
	unless(length($first) == 1 && length($second) == 1);

    if ($first eq 'a' && $second eq 't' ||
	$first eq 't' && $second eq 'a' ||
	$first eq 'g' && $second eq 'c' ||
	$first eq 'c' && $second eq 'g' ||
	$first eq 't' && $second eq 'g' && $gtmatch ||
	$first eq 'g' && $second eq 't' && $gtmatch
	)
    {
	return 1;
    }else{
	return 0;
    }

    my @argv = opt_get(@_);
    my $gb = opt_as_gb(shift @argv);
    my $start = -1;
    my @pos = ();
    my $dif = "ggtgcgcataatgtatattatgttaaat";

    while(0 <= ($start = index($gb->{SEQ}, $dif, $start + 1))){
	push(@pos, $start);
    }

    while(0 <= ($start = index($gb->{SEQ}, complement($dif), $start + 1))){
	push(@pos, $start);
    }

    return @pos;

    my @argv = opt_get(@_);
    my $gb = opt_as_gb(shift @argv);
    my $i = 0;
    my @pos = ();

    for ($i = 0; $i < length($gb->{SEQ}) - 8; $i ++){
	if (substr($gb->{SEQ}, $i, 9) =~ /(tt[at]t.caca)/){
	    push (@pos, $i);
	    msg_send(sprintf "%d %s\n", $i, $1);
	}elsif(substr($gb->{SEQ}, $i, 9) =~ /(tgtg.a[at]aa)/){
	    push (@pos, $i);
	    msg_send(sprintf "%d %s\n", $i, $1);
	}
    }

    return @pos;

    my $gb = opt_as_gb(shift);
    my $ref_Genome =\$ gb->{SEQ};
    my $sSeq = shift;
    my $printer=shift;
    my $sSeq2 = complement($sSeq);
    my $direct = 0;
    my $comp = 0;
    my $iSeqStart = 0;
    
    while(0 <= ($iSeqStart = index($$ref_Genome, $sSeq, $iSeqStart + 1))){
	$direct ++;
    }
    $iSeqStart = 0;
    while(0 <= ($iSeqStart = index($$ref_Genome, $sSeq2, $iSeqStart + 1))){
	$comp ++;
    }

    if($printer eq "f"){
	open(FILE,">>oligomer_count.rst");
	print FILE '--- find_sequence_result ---',"\n";
	print FILE "$sSeq: $direct\n$sSeq2: $comp\nTotal: $direct+$comp\n\n";
	close(FILE);
    }
    return ($direct, $comp, $direct + $comp);

    opt_default("nucleotide"=>"aa", "window"=>50, "filename"=>"aa_frequency.png", "output"=>"show");
    my @argv = opt_get(@_);
    my $gb = opt_as_gb(shift @argv);
    my $nuc = opt_val("nucleotide");
    my $window = opt_val("window");
    my $filename = opt_val("filename");
    my $output = opt_val("output");
    my @data = ();
    $data[$_] = 0 for (0..($window - 1));

    my $start = -1;
    while(0 <= ($start = index($gb->{SEQ}, $nuc, $start + 1))){
	my $innerPos = -1;
	my $localSeq = substr($gb->{SEQ}, $start + length($nuc), $window);
	while(0 <= ($innerPos = index($localSeq, $nuc, $innerPos + 1))){
	    $data[$innerPos]++;
	}
    }

    _UniMultiGrapher([0..($window - 1)],\@ data, -filename=>$filename);
    msg_gimv("graph/$filename") if ($output eq 'show');

    return @data;

    opt_default("window"=>0);
    my @args = opt_get(@_);
    my $gb = opt_as_gb(shift @args);
    my $seq = shift @args;
    my $window = opt_val("window");
    $window = length($gb->{SEQ}) if($window <= 0);

    if (opt_val("window")){
	open(OUT, '>oligo_count.csv') || &msg_error($!)
	    if (opt_val("output") eq "f");

	my $i = 0;
	my @wincount = ();
	my @winnum = ();
	for ($i = 0; $i <= int(length($gb->{SEQ}) / $window); $i ++){
	    my $partial = substr($gb->{SEQ}, $i * $window, $window);
	    last if (length($partial) < $window);
	    my $start = 0;
	    my $count = 0;
	    if (length($seq) == 1 && $seq =~ /a|t|g|c/){
		$count = $partial =~ tr/a/a/ if ($seq eq 'a');
		$count = $partial =~ tr/t/t/ if ($seq eq 't');
		$count = $partial =~ tr/g/g/ if ($seq eq 'g');
		$count = $partial =~ tr/c/c/ if ($seq eq 'c');
	    }else{
		while(0 <= ($start = index($partial, $seq, $start + 1))){
		    $count ++;
		}
	    }
	    push (@wincount, $count);
	    push (@winnum, $i * $window);
	    print OUT "%d,%d\n", $i*$window, $count
		if (opt_val("output") eq "f");
	}
	close(OUT) if (opt_val("output") eq "f");
	if (opt_val("output") eq "g"){
	    _UniMultiGrapher(\@winnum,\@ wincount, -x=>'window(bp)', 
			  -y=>'number of oligomer', 
			  -title=>'oligomer by window',
			  -outfile=>'oligo_count.png'
			  );
	}
	return (@wincount);
    }else{
	my $start = 0;
	my $count = 0;
	while(0 <= ($start = index($gb->{SEQ}, $seq, $start + 1))){
	    $count ++;
	}
	return $count;

    &opt_default(gtmatch=>0, loop=>0, shortest=>4, -output=>"stdout", -filename=>"palindrome.csv");
    my @args = opt_get(@_);
    my $gb = opt_as_gb(shift @args);
    my $length = int(opt_val("shortest") / 2);
    my $output = opt_val("output");
    my $filename = opt_val("filename");

    my %palindrome;

    my $i = $length - 1; 
    my ($len, $j, $k, $stem);

    if (opt_val("output") eq "f"){
	open(OUT, '>' . $filename) || &msg_error("G::Seq::PatSearch::palindrome() $! $filename");
	print OUT "Length, start, end, sequence\n";
    }

    while($i <= length($gb->{SEQ}) - 1 - $length - opt_val("loop")){
	$stem = opt_val("loop");

	while($stem >= 0){
	    $j = $i;
	    $k = $stem + 1 + $i;
	    $len = 0;
	    last if ($k > length($gb->{SEQ}) - 1);

	    while(&baseParingTest(substr($gb->{SEQ}, $j, 1), 
			       substr($gb->{SEQ}, $k, 1),
			       &opt_val("gtmatch")) 
		  )
	    {
		$j --;
		$k ++;
		last if ($j < 0 || $k > length($gb->{SEQ}) - 1);
		$len += 2;
	    }

	    if ($len >= opt_val("shortest")){
		&msg_send(sprintf("Length: %2d Position: %7d %7d Sequence: %s %s %s\n",
		$len, $j + 1, $k - 2, 
		substr($gb->{SEQ}, $j + 1, $len/2),
		substr($gb->{SEQ}, $j + 1 + $len/2, $stem),
		substr($gb->{SEQ}, $j + 1 + $len/2 + $stem, $len/2))) if ($output eq 'stdout');

		if ($output eq "f"){
		    printf OUT "%d,%d,%d,%s %s %s\n",
		    $len, $j + 1, $k - 2, 
		    substr($gb->{SEQ}, $j + 1, $len/2),
		    substr($gb->{SEQ}, $j + 1 + $len/2, $stem),
		    substr($gb->{SEQ}, $j + 1 + $len/2 + $stem, $len/2);
		}

		$palindrome{$j + 1} = sprintf("%s %s %s", 
					      substr($gb->{SEQ}, $j + 1, $len/2),
					      substr($gb->{SEQ}, $j + 1 + $len/2, $stem),
					      substr($gb->{SEQ}, $j + 1 + $len/2 + $stem, $len/2)
					      );
	    }

	    $stem --;
	}
	$i ++;
    }
    close(OUT) if ($output eq "f");

    return\% palindrome;

    
    Kazuharu Arakawa (gaou@sfc.keio.ac.jp)

  Description:
    Base pairing check
    
  Usage: 
    boolean $match = match_test(char $first, char $second, boolean $gtmatch);
    
  Options:
    none
    
  Author: 
    Kazuharu Arakawa (gaou@sfc.keio.ac.jp)
    
  History:
    20010829-01 initial posting