User Tools

Site Tools


kbws_readme

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

kbws_readme [2011/01/18 07:24]
cory
kbws_readme [2014/01/18 07:44]
Line 1: Line 1:
-====== KBWS EMBASSY package ver. 1.0.6 ====== 
-KEIO Bioinformatics Web Service (http://​www.g-language.org/​kbws/​) 
  
-===== Copyright ===== 
-All rights reserved. Copyright (C) 2010 by OSHITA Kazuki. 
- 
-This EMBASSY package is free software for non-commercial and 
-education use only (limited due to wsdl2h); you can redistribute it 
-and/or modify it under the terms of the GNU General Public License as 
-published by the Free Software Foundation, either version 2 of the 
-License, or any later version expect commercial use. 
-===== About ===== 
-This is an EMBASSY package for the utilization of bioinformatics web servcie. 
- 
-All of the tools included in this package are wrapper programs to utilize 
-KBWS SOAP services, which are web APIs to access numerous bioinformatics 
-web services under unified interface with SOAP 1.1. 
- 
-Detailed documentation about KBWS SOAP services are available at 
-http://​www.g-language.org/​kbws/​. 
-===== Installation ===== 
- 
-=== REQUIREMENT === 
-EMBOSS (> 6.2.0) - This EMBASSY package requires EMBOSS version 6.2.0 or above. 
- 
-=== INSTALLATION === 
-In the following examples, we assume downloaded EMBOSS filename is EMBOSS-6.3.1.tar.gz. 
- 
-1. Download and compile EMBOSS source code 
-    % wget ftp://​emboss.open-bio.org/​pub/​EMBOSS/​EMBOSS-latest.tar.gz 
-      (or "curl -O ftp://​emboss.open-bio.org/​pub/​EMBOSS/​EMBOSS-latest.tar.gz"​) 
-    % tar -xzf EMBOSS-6.3.1.tar.gz 
-    % cd EMBOSS-6.3.1 
-    % ./configure 
-    % make 
-    % sudo make install 
- 
-2. Make new directory "​embassy"​ (in EMBOSS-6.3.1/​ directory) if it does not exist already 
-    % mkdir embassy 
- 
-3. Go into that directory. 
-    % cd embassy 
- 
-4. Place KBWS file in current directory 
-    % wget http://​www.g-language.org/​kbws/​source/​KBWS-1.0.6.tar.gz 
-       (or "curl -O http://​www.g-language.org/​kbws/​source/​KBWS-1.0.5.tar.gz"​) 
- 
-5. Uncompress the KBWS tarball package, and go into the new KBWS directory 
-   % tar xzf KBWS-1.0.6.tar.gz 
-   % cd KBWS-1.0.6 
-    ( EMBOSS-6.3.1/​embassy/​KBWS-1.0.6 ) 
- 
-6. Configure and compile 
-   % ./configure (use same options as you used to compile emboss) 
-   % make 
-   % sudo make install 
- 
-=== Note === 
- 
-== libtool problem == 
-On some systems there may be compatibility problems with different 
-automake, autoconf or libtool versions. If a libtool problem 
-arises you can try deleting the following files: 
-   ​config.cache 
-   ​ltmain.sh 
-   ​ltconfig 
-   ​libtool 
-and then type 
-   % aclocal -I m4 
-   % autoconf 
-   % automake -a 
-and then retry make. 
- 
-== Update of EMBOSS == 
-When you are upgrading EMBOSS, please be sure to uninstall old version of EMBOSS and KBWS. If you override them, some older version of files may cause errors. 
- 
-== EMBOSS is already installed == 
-When EMBOSS is already installed in your system, please install KBWS at the same PATH as existed EMBOSS by '​--prefix'​ option. 
- 
-== Non-root users (using '​--prefix'​ option) == 
-If you use "​./​configure"​ command with "​--prefix"​ option, please rewrite "​emboss_acdroot"​ and "​emboss_data"​ value in ~/.embossrc file. Please check "​~/​.embossrc"​ file for further informations. 
-===== QuickStart ===== 
- 
-=== DATABASE DEFINITION === 
-The database definitions for following commands are available at "​KBWS-1.0.6/​data/​embossrc-template"​. ​ 
- 
-The latest version is available at following URL: 
-http://​soap.g-language.org/​kbws/​embossrc 
- 
-=== Information of KBWS tools === 
- 
-== List of all tools == 
- 
-If you want to get list of all tools included in KBWS, you can try 
-the below command. 
- 
-      % wossname -showembassy KBWS 
- 
-== Documentation == 
- 
-You can view available documentations with "​tfm"​ utility included in EMBOSS. 
- 
-      % tfm kblast # example for "​kblast"​ 
- 
-=== Usage example === 
- 
-Sample files used in this section are available from EMBOSS package. 
-( EMBOSS-6.3.1/​test/​data/​* ) 
- 
-1. kblast (BLAST) 
-      % kblast swissprot:​FOXP2_HUMAN -d swissprot -format 8 -eval 1e-100 
-      Search similar sequences in public repositories using BLAST 
-      Output file [foxp2_human.kblast]:​ 
-      Jobid: kbws_4981686 
-      ****** 
-      ​ 
-      % cat foxp2_human.kblast 
-      query     ​sp|Q8MJ98.3|FOXP2_PONPY 99      457     ​1 ​      ​0 ​      ​240 ​    ​697 ​    ​238 ​    ​695 ​    ​0.0 ​    2005 
-      query     ​sp|Q5QL03.1|FOXP2_HYLLA 99      457     ​1 ​      ​0 ​      ​240 ​    ​697 ​    ​238 ​    ​695 ​    ​0.0 ​    2005 
-      query     ​sp|Q8MJ99.1|FOXP2_GORGO 99      457     ​1 ​      ​0 ​      ​240 ​    ​697 ​    ​238 ​    ​695 ​    ​0.0 ​    2005 
-      query     ​sp|Q8MJA0.1|FOXP2_PANTR 99      457     ​1 ​      ​0 ​      ​240 ​    ​697 ​    ​241 ​    ​698 ​    ​0.0 ​    2005 
-      query     ​sp|P58463.2|FOXP2_MOUSE 99      457     ​1 ​      ​0 ​      ​240 ​    ​697 ​    ​239 ​    ​696 ​    ​0.0 ​    2005 
-      query     ​sp|Q8MJ97.1|FOXP2_MACMU 99      457     ​1 ​      ​0 ​      ​240 ​    ​697 ​    ​239 ​    ​696 ​    ​0.0 ​    2005 
-      query     ​sp|O15409.2|FOXP2_HUMAN 100     ​458 ​    ​0 ​      ​0 ​      ​240 ​    ​697 ​    ​240 ​    ​697 ​    ​0.0 ​    2005 
-      query     ​sp|P0CF24.1|FOXP2_RAT ​  ​99 ​     456     ​2 ​      ​0 ​      ​240 ​    ​697 ​    ​235 ​    ​692 ​    ​0.0 ​    2000 
-      query     ​sp|Q4VYS1.1|FOXP2_XENLA 95      450     ​8 ​      ​0 ​      ​240 ​    ​697 ​    ​231 ​    ​688 ​    ​0.0 ​    1948 
-      query     ​sp|Q5W1J5.1|FOXP1_XENLA 68      373     ​87 ​     6       ​240 ​    ​697 ​    ​105 ​    ​560 ​    ​8e-148 ​ 1350 
-      query     ​sp|A4IFD2.1|FOXP1_BOVIN 66      371     ​89 ​     6       ​240 ​    ​697 ​    ​201 ​    ​656 ​    ​4e-146 ​ 1335 
-      query     ​sp|Q9H334.1|FOXP1_HUMAN 66      372     ​89 ​     7       ​240 ​    ​697 ​    ​203 ​    ​659 ​    ​2e-144 ​ 1321 
-      query     ​sp|Q498D1.1|FOXP1_RAT ​  ​65 ​     371     ​90 ​     7       ​240 ​    ​697 ​    ​237 ​    ​693 ​    ​9e-144 ​ 1315 
-      query     ​sp|P58462.1|FOXP1_MOUSE 65      372     ​89 ​     7       ​240 ​    ​697 ​    ​231 ​    ​687 ​    ​1e-143 ​ 1314 
-      query     ​sp|Q58NQ4.1|FOXP1_CHICK 65      369     ​92 ​     7       ​240 ​    ​697 ​    ​212 ​    ​668 ​    ​1e-143 ​ 1313 
-      query     ​sp|Q8IVH2.1|FOXP4_HUMAN 60      332     ​119 ​    ​5 ​      ​240 ​    ​686 ​    ​201 ​    ​650 ​    ​6e-131 ​ 1204 
-      query     ​sp|Q9DBY0.1|FOXP4_MOUSE 60      332     ​118 ​    ​17 ​     240     ​686 ​    ​207 ​    ​642 ​    ​2e-126 ​ 1166 
-      query     ​sp|Q4VYR7.1|FOXP4_XENLA 58      336     ​120 ​    ​20 ​     241     ​696 ​    ​187 ​    ​622 ​    ​6e-126 ​ 1161 
- 
- 
-2. kcentroidfold (Centroid Fold) 
-      % kcentroidfold 
-      RNA 2D structure prediction from an RNA sequence using CentroidFold 
-      Input (gapped) sequence(s):​ dna.fasta 
-      Output file [fasta.centroidfold]:​ 
-      Jobid: 13401346 
-      *********** 
-      http://​soap.g-language.org/​result/​13401346.png 
-      ​ 
-      % cat fasta.centroidfold 
-      >FASTA 
-      ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT 
-      ((((((((((((((((((((((((((((((((((((((((((((((((....)))))))))))))))))))))))))))))))))))))))))))))))) 
-      % wget http://​soap.g-language.org/​result/​13401346.png 
- 
-3. kweblogo (WebLogo) 
-   % kweblogo dna.m-fasta 
-   make the generation of sequence logos using WebLogo 
-   ​Jobid:​ 3203930 
-   ** 
-   ​http://​soap.g-language.org/​alis/​result/​3203930.png 
- 
-=== Sample data === 
- 
-You can use sample data included in EMBOSS. 
-Please check test/ directory in EMBOSS package. 
- 
- 
-===== Content ===== 
-  * gSOAP Toolkit 
-This EMBASSY package is depended on gSOAP Toolkit to use SOAP 
-transfer, which is included in gsoap/ directory and automatically used during 
-compilation. 
- 
-===== Contact ===== 
-  Kazuki Oshita < cory@g-language.org > 
-    Institute for Advanced Biosciences,​ Keio University. 
kbws_readme.txt ยท Last modified: 2014/01/18 07:44 (external edit)