User Tools

Site Tools


kbws_readme

KBWS EMBASSY package ver. 1.0.9

KEIO Bioinformatics Web Service (http://www.g-language.org/kbws/)

All rights reserved. Copyright (C) 2010 by OSHITA Kazuki.

This EMBASSY package is free software for non-commercial and education use only (limited due to wsdl2h); you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 2 of the License, or any later version expect commercial use.

About

This is an EMBASSY package for the utilization of bioinformatics web servcie.

All of the tools included in this package are wrapper programs to utilize KBWS SOAP services, which are web APIs to access numerous bioinformatics web services under unified interface with SOAP 1.1.

Detailed documentation about KBWS SOAP services are available at http://www.g-language.org/kbws/.

Installation

REQUIREMENT

EMBOSS (> 6.5.7) - This EMBASSY package requires EMBOSS version 6.5.7 or above.

INSTALLATION

In the following examples, we assume downloaded EMBOSS filename is EMBOSS-latest.tar.gz (EMBOSS-6.5.7).

1. Download and compile EMBOSS source code

  % wget ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-latest.tar.gz
    (or "curl -O ftp://emboss.open-bio.org/pub/EMBOSS/EMBOSS-latest.tar.gz")
  % tar xzf EMBOSS-latest.tar.gz
  % cd EMBOSS-6.5.7
  % ./configure
  % make
  % sudo make install

2. Make new directory "embassy" (in EMBOSS-6.5.7/ directory) if it does not exist already

  % mkdir embassy

3. Go into that directory.

  % cd embassy

4. Place KBWS file in current directory

  % wget http://www.g-language.org/kbws/source/KBWS-1.0.9.tar.gz
     (or "curl -O http://www.g-language.org/kbws/source/KBWS-1.0.9.tar.gz")

5. Uncompress the KBWS tarball package, and go into the new KBWS directory

 % tar xzf KBWS-1.0.9.tar.gz
 % cd KBWS-1.0.9
  ( EMBOSS-6.5.7/embassy/KBWS-1.0.9 )

6. Configure and compile

 % ./configure (use same options as you used to compile emboss)
 % make
 % sudo make install

Note

libtool problem

On some systems there may be compatibility problems with different automake, autoconf or libtool versions. If a libtool problem arises you can try deleting the following files:

 config.cache
 ltmain.sh
 ltconfig
 libtool

and then type

 % aclocal -I m4
 % autoconf
 % automake -a

and then retry make.

Update of EMBOSS

When you are upgrading EMBOSS, please be sure to uninstall old version of EMBOSS and KBWS. If you override them, some older version of files may cause errors.

EMBOSS is already installed

When EMBOSS is already installed in your system, please install KBWS at the same PATH as existed EMBOSS by '–prefix' option.

Non-root users (using '--prefix' option)

If you use "./configure" command with "--prefix" option, please rewrite "emboss_acdroot" and "emboss_data" value in ~/.embossrc file. Please check "~/.embossrc" file for further informations.

QuickStart

DATABASE DEFINITION

The database definitions for following commands are available at "KBWS-1.0.9/data/embossrc-template".

The latest version is available at following URL: http://soap.g-language.org/kbws/embossrc

Information of KBWS tools

List of all tools

If you want to get list of all tools included in KBWS, you can try the below command.

    % wossname -showembassy KBWS
Documentation

You can view available documentations with "tfm" utility included in EMBOSS.

    % tfm kblast # example for "kblast"

Usage example

Sample files used in this section are available from EMBOSS package. ( EMBOSS-6.4.0/test/data/* )

1. kblast (BLAST)

    % kblast swissprot:FOXP2_HUMAN -d swissprot -format 8 -eval 1e-100
    Search similar sequences in public repositories using BLAST
    Output file [foxp2_human.kblast]:
    
    % cat foxp2_human.kblast
    query     sp|Q8MJ98.3|FOXP2_PONPY 99      457     1       0       240     697     238     695     0.0     2005
    query     sp|Q5QL03.1|FOXP2_HYLLA 99      457     1       0       240     697     238     695     0.0     2005
    query     sp|Q8MJ99.1|FOXP2_GORGO 99      457     1       0       240     697     238     695     0.0     2005
    query     sp|Q8MJA0.1|FOXP2_PANTR 99      457     1       0       240     697     241     698     0.0     2005
    query     sp|P58463.2|FOXP2_MOUSE 99      457     1       0       240     697     239     696     0.0     2005
    query     sp|Q8MJ97.1|FOXP2_MACMU 99      457     1       0       240     697     239     696     0.0     2005
    query     sp|O15409.2|FOXP2_HUMAN 100     458     0       0       240     697     240     697     0.0     2005
    query     sp|P0CF24.1|FOXP2_RAT   99      456     2       0       240     697     235     692     0.0     2000
    query     sp|Q4VYS1.1|FOXP2_XENLA 95      450     8       0       240     697     231     688     0.0     1948
    query     sp|Q5W1J5.1|FOXP1_XENLA 68      373     87      6       240     697     105     560     8e-148  1350
    query     sp|A4IFD2.1|FOXP1_BOVIN 66      371     89      6       240     697     201     656     4e-146  1335
    query     sp|Q9H334.1|FOXP1_HUMAN 66      372     89      7       240     697     203     659     2e-144  1321
    query     sp|Q498D1.1|FOXP1_RAT   65      371     90      7       240     697     237     693     9e-144  1315
    query     sp|P58462.1|FOXP1_MOUSE 65      372     89      7       240     697     231     687     1e-143  1314
    query     sp|Q58NQ4.1|FOXP1_CHICK 65      369     92      7       240     697     212     668     1e-143  1313
    query     sp|Q8IVH2.1|FOXP4_HUMAN 60      332     119     5       240     686     201     650     6e-131  1204
    query     sp|Q9DBY0.1|FOXP4_MOUSE 60      332     118     17      240     686     207     642     2e-126  1166
    query     sp|Q4VYR7.1|FOXP4_XENLA 58      336     120     20      241     696     187     622     6e-126  1161

2. kcentroidfold (Centroid Fold)

    % kcentroidfold
    RNA 2D structure prediction from an RNA sequence using CentroidFold
    Input (gapped) sequence(s): dna.fasta
    Output image file name [kcentroidfold.png]:
    Output file [fasta.centroidfold]:
    % ls kcentroidfold.png
    kcentroidfold.png
    
    % cat fasta.centroidfold
    >FASTA
    ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
    ((((((((((((((((((((((((((((((((((((((((((((((((....))))))))))))))))))))))))))))))))))))))))))))))))
    % wget http://soap.g-language.org/result/13401346.png

3. kweblogo (WebLogo)

 % kweblogo dna.m-fasta
 make the generation of sequence logos using WebLogo
 Output file name [kweblogo.png]:
 
 % ls kweblogo.png
 kweblogo.png

Sample data

You can use sample data included in EMBOSS. Please check test/ directory in EMBOSS package.

Content

  • gSOAP Toolkit

This EMBASSY package is depended on gSOAP Toolkit to use SOAP transfer, which is included in gsoap/ directory and automatically used during compilation.

Contact

Kazuki Oshita < cory@g-language.org >
  Institute for Advanced Biosciences, Keio University.
kbws_readme.txt · Last modified: 2014/01/18 07:44 (external edit)